|
Addgene inc
shctrl f 5 Shctrl F 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pm39657676-812-9-57?v=Addgene+inc Average 93 stars, based on 1 article reviews
shctrl f 5 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
GemPharmatech Co Ltd
shctrl 3/4 ![]() Shctrl 3/4, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pmc11321678-388-8-28?v=GemPharmatech+Co+Ltd Average 90 stars, based on 1 article reviews
shctrl 3/4 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GemPharmatech Co Ltd
shhtr2c, shgabrg2, and shctrl 3/4 cells ![]() Shhtr2c, Shgabrg2, And Shctrl 3/4 Cells, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pm38884167-504-3-27?v=GemPharmatech+Co+Ltd Average 90 stars, based on 1 article reviews
shhtr2c, shgabrg2, and shctrl 3/4 cells - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
shrnas targeting rosa26 (shctrl) and the 3'-untranslated region (3'-utr) of thoc1, stau1, serbp1, and skiv2l ![]() Shrnas Targeting Rosa26 (Shctrl) And The 3' Untranslated Region (3' Utr) Of Thoc1, Stau1, Serbp1, And Skiv2l, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/10__1172_slash_jci163325-320-17-26?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
shrnas targeting rosa26 (shctrl) and the 3'-untranslated region (3'-utr) of thoc1, stau1, serbp1, and skiv2l - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 ![]() Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pmc10140597-109-0-5?v=Addgene+inc Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
shctrl 5’-cctaaggttaagtcgccctcgctc-3 ![]() Shctrl 5’ Cctaaggttaagtcgccctcgctc 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pmc09883185-82-0-3?v=Addgene+inc Average 90 stars, based on 1 article reviews
shctrl 5’-cctaaggttaagtcgccctcgctc-3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Genechem
egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3 ![]() Egfr Knockdown Lentiviral Vectors Shctrl, Shegfr 1, Shegfr 2, Shegfr 3, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pmc09132982-279-8-26?v=Genechem Average 90 stars, based on 1 article reviews
egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
shrna negative control (shctrl; cat. no. 131127cz; 5′-ttctccgaacgtgtcacgtttc-3′) ![]() Shrna Negative Control (Shctrl; Cat. No. 131127cz; 5′ Ttctccgaacgtgtcacgtttc 3′), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pmc07751351-45-13-26?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
shrna negative control (shctrl; cat. no. 131127cz; 5′-ttctccgaacgtgtcacgtttc-3′) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Genechem
non-silencing control (shctrl, target sequence 5’–ttctccgaacgtgtcacgt–3) ![]() Non Silencing Control (Shctrl, Target Sequence 5’–Ttctccgaacgtgtcacgt–3), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+3/pmc06991670-63-13-22?v=Genechem Average 90 stars, based on 1 article reviews
non-silencing control (shctrl, target sequence 5’–ttctccgaacgtgtcacgt–3) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Journal: Advanced Science
Article Title: Single‐Cell Chromatin Accessibility Analysis Reveals Subgroup‐Specific TF‐NTR Regulatory Circuits in Medulloblastoma
doi: 10.1002/advs.202309554
Figure Lengend Snippet: Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA (shCtrl), shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
Article Snippet: Subsequently, 1 × 10 6 shHTR2C, shGABRG2, and
Techniques: In Vitro, In Vivo, Inhibition, Derivative Assay, Expressing, Control, shRNA, Incubation, Quantitative RT-PCR, Staining, Immunofluorescence
Journal: Oncology Letters
Article Title: Inhibition of autophagy enhances apoptosis induced by bortezomib in AML cells
doi: 10.3892/ol.2020.12370
Figure Lengend Snippet: Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control shRNA and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short hairpin RNA; CTRL, control; PARP, poly(ADP-ribose) polymerase.
Article Snippet: Lentiviral particles containing short hairpin RNA (shRNA/sh) Beclin-1 (cat. no. 131209BZ; 5′-CCGACTTGTTCCTTACGGAAA-3′) and
Techniques: Infection, Expressing, Transfection, shRNA, Western Blot, Standard Deviation