Review





Similar Products

93
Addgene inc shctrl f 5
Shctrl F 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pm39657676-812-9-57?v=Addgene+inc
Average 93 stars, based on 1 article reviews
shctrl f 5 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
GemPharmatech Co Ltd shctrl 3/4
Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
Shctrl 3/4, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pmc11321678-388-8-28?v=GemPharmatech+Co+Ltd
Average 90 stars, based on 1 article reviews
shctrl 3/4 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GemPharmatech Co Ltd shhtr2c, shgabrg2, and shctrl 3/4 cells
Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
Shhtr2c, Shgabrg2, And Shctrl 3/4 Cells, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pm38884167-504-3-27?v=GemPharmatech+Co+Ltd
Average 90 stars, based on 1 article reviews
shhtr2c, shgabrg2, and shctrl 3/4 cells - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH shrnas targeting rosa26 (shctrl) and the 3'-untranslated region (3'-utr) of thoc1, stau1, serbp1, and skiv2l
Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
Shrnas Targeting Rosa26 (Shctrl) And The 3' Untranslated Region (3' Utr) Of Thoc1, Stau1, Serbp1, And Skiv2l, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/10__1172_slash_jci163325-320-17-26?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
shrnas targeting rosa26 (shctrl) and the 3'-untranslated region (3'-utr) of thoc1, stau1, serbp1, and skiv2l - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Addgene inc plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3
Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pmc10140597-109-0-5?v=Addgene+inc
Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Addgene inc shctrl 5’-cctaaggttaagtcgccctcgctc-3
Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
Shctrl 5’ Cctaaggttaagtcgccctcgctc 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pmc09883185-82-0-3?v=Addgene+inc
Average 90 stars, based on 1 article reviews
shctrl 5’-cctaaggttaagtcgccctcgctc-3 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Genechem egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3
Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
Egfr Knockdown Lentiviral Vectors Shctrl, Shegfr 1, Shegfr 2, Shegfr 3, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pmc09132982-279-8-26?v=Genechem
Average 90 stars, based on 1 article reviews
egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma shrna negative control (shctrl; cat. no. 131127cz; 5′-ttctccgaacgtgtcacgtttc-3′)
Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control <t>shRNA</t> and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short <t>hairpin</t> <t>RNA;</t> CTRL, control; PARP, poly(ADP-ribose) polymerase.
Shrna Negative Control (Shctrl; Cat. No. 131127cz; 5′ Ttctccgaacgtgtcacgtttc 3′), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pmc07751351-45-13-26?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
shrna negative control (shctrl; cat. no. 131127cz; 5′-ttctccgaacgtgtcacgtttc-3′) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Genechem non-silencing control (shctrl, target sequence 5’–ttctccgaacgtgtcacgt–3)
Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control <t>shRNA</t> and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short <t>hairpin</t> <t>RNA;</t> CTRL, control; PARP, poly(ADP-ribose) polymerase.
Non Silencing Control (Shctrl, Target Sequence 5’–Ttctccgaacgtgtcacgt–3), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+3/pmc06991670-63-13-22?v=Genechem
Average 90 stars, based on 1 article reviews
non-silencing control (shctrl, target sequence 5’–ttctccgaacgtgtcacgt–3) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA (shCtrl), shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).

Journal: Advanced Science

Article Title: Single‐Cell Chromatin Accessibility Analysis Reveals Subgroup‐Specific TF‐NTR Regulatory Circuits in Medulloblastoma

doi: 10.1002/advs.202309554

Figure Lengend Snippet: Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA (shCtrl), shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).

Article Snippet: Subsequently, 1 × 10 6 shHTR2C, shGABRG2, and shCtrl Group 3/4 cells in 2 μl PBS were carefully injected into the cerebellum of 6–8week‐old female nude mice (BABL/c, Gempharmatech Co., Ltd, China) at the coordinates 2 mm lateral to midline and 1 mm posterior to lambda.

Techniques: In Vitro, In Vivo, Inhibition, Derivative Assay, Expressing, Control, shRNA, Incubation, Quantitative RT-PCR, Staining, Immunofluorescence

Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control shRNA and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short hairpin RNA; CTRL, control; PARP, poly(ADP-ribose) polymerase.

Journal: Oncology Letters

Article Title: Inhibition of autophagy enhances apoptosis induced by bortezomib in AML cells

doi: 10.3892/ol.2020.12370

Figure Lengend Snippet: Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control shRNA and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short hairpin RNA; CTRL, control; PARP, poly(ADP-ribose) polymerase.

Article Snippet: Lentiviral particles containing short hairpin RNA (shRNA/sh) Beclin-1 (cat. no. 131209BZ; 5′-CCGACTTGTTCCTTACGGAAA-3′) and shRNA negative control (shCTRL; cat. no. 131127CZ; 5′-TTCTCCGAACGTGTCACGTTTC-3′) expression vectors were obtained from Shanghai GenePharma Co., Ltd., and were then cloned into pGLV3/H1/GFP-Puro vector (Shanghai GenePharma Co., Ltd.).

Techniques: Infection, Expressing, Transfection, shRNA, Western Blot, Standard Deviation